CDS

Accession Number TCMCG023C26179
gbkey CDS
Protein Id PIN01056.1
Location 33047..33454
Organism Handroanthus impetiginosus
locus_tag CDL12_26442

Protein

Length 135aa
Molecule type protein
Topology linear
Data_file_division PLN
dblink BioProject:PRJNA324125, BioSample:SAMN05195323
db_source NKXS01006616.1
Definition NADH dehydrogenase (quinone) [Handroanthus impetiginosus]
Locus_tag CDL12_26442

EGGNOG-MAPPER Annotation

COG_category C
Description NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient
KEGG_TC -
KEGG_Module M00145        [VIEW IN KEGG]
KEGG_Reaction R11945        [VIEW IN KEGG]
KEGG_rclass RC00061        [VIEW IN KEGG]
BRITE ko00000        [VIEW IN KEGG]
ko00001        [VIEW IN KEGG]
ko00002        [VIEW IN KEGG]
ko01000        [VIEW IN KEGG]
KEGG_ko ko:K05572        [VIEW IN KEGG]
ko:K05579        [VIEW IN KEGG]
EC 1.6.5.3        [VIEW IN KEGG]        [VIEW IN INGREDIENT]
KEGG_Pathway ko00190        [VIEW IN KEGG]
ko01100        [VIEW IN KEGG]
map00190        [VIEW IN KEGG]
map01100        [VIEW IN KEGG]
GOs GO:0003674        [VIEW IN EMBL-EBI]
GO:0003824        [VIEW IN EMBL-EBI]
GO:0003959        [VIEW IN EMBL-EBI]
GO:0005575        [VIEW IN EMBL-EBI]
GO:0005622        [VIEW IN EMBL-EBI]
GO:0005623        [VIEW IN EMBL-EBI]
GO:0005737        [VIEW IN EMBL-EBI]
GO:0005739        [VIEW IN EMBL-EBI]
GO:0005740        [VIEW IN EMBL-EBI]
GO:0005743        [VIEW IN EMBL-EBI]
GO:0005746        [VIEW IN EMBL-EBI]
GO:0005747        [VIEW IN EMBL-EBI]
GO:0006091        [VIEW IN EMBL-EBI]
GO:0008150        [VIEW IN EMBL-EBI]
GO:0008152        [VIEW IN EMBL-EBI]
GO:0009507        [VIEW IN EMBL-EBI]
GO:0009532        [VIEW IN EMBL-EBI]
GO:0009534        [VIEW IN EMBL-EBI]
GO:0009535        [VIEW IN EMBL-EBI]
GO:0009536        [VIEW IN EMBL-EBI]
GO:0009570        [VIEW IN EMBL-EBI]
GO:0009579        [VIEW IN EMBL-EBI]
GO:0009987        [VIEW IN EMBL-EBI]
GO:0015979        [VIEW IN EMBL-EBI]
GO:0015980        [VIEW IN EMBL-EBI]
GO:0016020        [VIEW IN EMBL-EBI]
GO:0016491        [VIEW IN EMBL-EBI]
GO:0016651        [VIEW IN EMBL-EBI]
GO:0019866        [VIEW IN EMBL-EBI]
GO:0030964        [VIEW IN EMBL-EBI]
GO:0031090        [VIEW IN EMBL-EBI]
GO:0031966        [VIEW IN EMBL-EBI]
GO:0031967        [VIEW IN EMBL-EBI]
GO:0031975        [VIEW IN EMBL-EBI]
GO:0031976        [VIEW IN EMBL-EBI]
GO:0031984        [VIEW IN EMBL-EBI]
GO:0032991        [VIEW IN EMBL-EBI]
GO:0034357        [VIEW IN EMBL-EBI]
GO:0042651        [VIEW IN EMBL-EBI]
GO:0043226        [VIEW IN EMBL-EBI]
GO:0043227        [VIEW IN EMBL-EBI]
GO:0043229        [VIEW IN EMBL-EBI]
GO:0043231        [VIEW IN EMBL-EBI]
GO:0044237        [VIEW IN EMBL-EBI]
GO:0044422        [VIEW IN EMBL-EBI]
GO:0044424        [VIEW IN EMBL-EBI]
GO:0044425        [VIEW IN EMBL-EBI]
GO:0044429        [VIEW IN EMBL-EBI]
GO:0044434        [VIEW IN EMBL-EBI]
GO:0044435        [VIEW IN EMBL-EBI]
GO:0044436        [VIEW IN EMBL-EBI]
GO:0044444        [VIEW IN EMBL-EBI]
GO:0044446        [VIEW IN EMBL-EBI]
GO:0044455        [VIEW IN EMBL-EBI]
GO:0044464        [VIEW IN EMBL-EBI]
GO:0045271        [VIEW IN EMBL-EBI]
GO:0045333        [VIEW IN EMBL-EBI]
GO:0055035        [VIEW IN EMBL-EBI]
GO:0055114        [VIEW IN EMBL-EBI]
GO:0070469        [VIEW IN EMBL-EBI]
GO:0098796        [VIEW IN EMBL-EBI]
GO:0098798        [VIEW IN EMBL-EBI]
GO:0098800        [VIEW IN EMBL-EBI]
GO:0098803        [VIEW IN EMBL-EBI]
GO:1902494        [VIEW IN EMBL-EBI]
GO:1990204        [VIEW IN EMBL-EBI]

Sequence

CDS:  
ATGCTTGGTGTTCTTCGACTAATTGTTACTCTTGATGGTGAAAATGTTATTGACTGTGAACCAATTTTGGGTTATTTACACAGAGGGAGGGAAAAAATTGCGAAAAGTCAAACAATTATACAATATTTGCCTTATGTAACACGTTGGGATTATTTAGCTGCTATGTTCACAAAAGCAATAACCATAAATGGGCCTAAAAAGCTAGGGAATATTCACGTACCTAAAAGGGCTAGCTATATTAGAGCTATTATATTGGAGTTGAGTTGTATCACTTCCCATTTGTTATGCCTTGGCCCTTTTATGGCAAATATTGGGGCACACACCCCTTTCTTCCATATTTTTCGAGAACGAGAATTGATATATGACCTATTCAAAGATGCTACTTTCTTCTGCAGTACCTCAACATGA
Protein:  
MLGVLRLIVTLDGENVIDCEPILGYLHRGREKIAKSQTIIQYLPYVTRWDYLAAMFTKAITINGPKKLGNIHVPKRASYIRAIILELSCITSHLLCLGPFMANIGAHTPFFHIFRERELIYDLFKDATFFCSTST